WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042619 Gene Name  CBG24529
Sequence Name  ? CBG24529 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Srh and 7TM GPCR, serpentine receptor class h (Srh). Is an ortholog of C. elegans srh-99; srh-98; and srh-97. Biotype  SO:0001217
Genetic Position 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG24529.1 CBG24529.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG24529 CBG24529   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00134326
WBVar00050919

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG24529, AACTTCAATTCCGGTATTAACTCTTATGATACCTCCACTTGTCTTGATATTTTTATTTTC, WBGene00042619   Expr1065448 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term