WormMine: Gene WBGene00025957

• WormBase Gene ID: WBGene00025957
• Gene Name: Cbr-mpz-1
• Sequence Name: CBG03011
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: PDZ domain and PDZ superfamily. Is an ortholog of C. elegans mpz-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03011a.1	CBG03011a.1		[unknown]
Transcript:CBG03011b.1	CBG03011b.1		[unknown]
Transcript:CBG03011c.1	CBG03011c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03011c	CBG03011c		[unknown]
CDS:CBG03011a	CBG03011a		[unknown]
CDS:CBG03011b	CBG03011b		[unknown]

0 RNAi Result

35 Allele

• WBVar00136027
• WBVar00136028
• WBVar00141817
• WBVar00141818
• WBVar00141819
• WBVar00141821
• WBVar00141822
• WBVar00141823
• WBVar00141820
• WBVar00107987
• WBVar00107986
• WBVar00107985
• WBVar00107984
• WBVar00107983
• WBVar00107982
• WBVar00107981
• WBVar00107980
• WBVar00107979
• WBVar00107978
• WBVar00107977
• WBVar00107990
• WBVar00107998
• WBVar00107997
• WBVar00107996
• WBVar00107995
• WBVar00107994
• WBVar00107993
• WBVar00107992
• WBVar00107991
• WBVar00107989

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063159
• Remark: Cbr-mpz-1, ACGATGGACGGCTGAAACCTGGAGATCAAGTTCTAGAAGTAAATGGAACGTCGTTAAGAG, WBGene00025957
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term