WormMine: Gene WBGene00025906

• WormBase Gene ID: WBGene00025906
• Gene Name: Cbr-srap-1
• Sequence Name: CBG02948
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: PAN/Apple domain; Repeat of unknown function (DUF1174); and Repeat of unknown function DUF1174. Is an ortholog of C. elegans srap-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02948a.1	CBG02948a.1		[unknown]
Transcript:CBG02948d.1	CBG02948d.1		[unknown]
Transcript:CBG02948c.1	CBG02948c.1		[unknown]
Transcript:CBG02948b.1	CBG02948b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02948a	CBG02948a		[unknown]
CDS:CBG02948b	CBG02948b		[unknown]
CDS:CBG02948c	CBG02948c		[unknown]
CDS:CBG02948d	CBG02948d		[unknown]

0 RNAi Result

5 Allele

• WBVar00136014
• WBVar00136015
• WBVar00107910
• WBVar00107912
• WBVar00107911

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054905
• Remark: CBG02948, GAAGTTGCCACACAAATCCACGACTCTCTTCTGCCAATCAGTATTGAATGCGTCAAGTGT, WBGene00025906
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term