WormMine: Gene WBGene00025219

• WormBase Gene ID: WBGene00025219
• Gene Name: Cbr-syg-1
• Sequence Name: CBG02095
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin I-set domain; Immunoglobulin I-set; Immunoglobulin subtype; Immunoglobulin-like fold; Immunoglobulin domain; CD80-like C2-set immunoglobulin domain; CD80-like, immunoglobulin C2-set; Immunoglobulin subtype 2; and Immunoglobulin-like domain superfamily. Is an ortholog of C. elegans syg-1. In C. elegans, syg-1 is involved in actin filament bundle assembly; cell-cell signaling; and nervous system development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02095.1	CBG02095.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02095	CBG02095		[unknown]

0 RNAi Result

4 Allele

• WBVar00135922
• WBVar00135923
• WBVar00135924
• WBVar00135925

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057082
• Remark: Cbr-syg-1, GAAGTGGATTCTGTCAAACTGGCACTACGCTACGCGCCTCAAATCAATCTTACTATTGCA, WBGene00025219
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term