WormMine: Gene WBGene00024582

• WormBase Gene ID: WBGene00024582
• Gene Name: CBG01325
• Sequence Name: CBG01325
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: C-type lectin-like/link domain superfamily; Lectin C-type domain; Spermadhesin, CUB domain superfamily; C-type lectin-like; and C-type lectin fold.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01325.1	CBG01325.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01325	CBG01325		[unknown]

0 RNAi Result

11 Allele

• WBVar00135810
• WBVar00135811
• WBVar00135812
• WBVar00135813
• WBVar00135814
• WBVar00135815
• WBVar00135816
• WBVar00135817
• WBVar00135818
• WBVar00135819
• WBVar00135809

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1070162
• Remark: CBG01325, AACTGCTACTGGAGGTCTAAAACCTTAGTAAATGGAGCATTGATGAACTTTGTCGATGCG, WBGene00024582
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term