WormMine: Gene WBGene00031307

• WormBase Gene ID: WBGene00031307
• Gene Name: CBG09784
• Sequence Name: CBG09784
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: PAN/Apple domain and PAN domain. Is an ortholog of C. elegans C34C12.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09784a.1	CBG09784a.1		[unknown]
Transcript:CBG09784a.2	CBG09784a.2		[unknown]
Transcript:CBG09784b.1	CBG09784b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09784b	CBG09784b		[unknown]
CDS:CBG09784a	CBG09784a		[unknown]

0 RNAi Result

7 Allele

• WBVar00137125
• WBVar00115248
• WBVar00115244
• WBVar00115245
• WBVar00115246
• WBVar00115247
• WBVar00115243

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052431
• Remark: CBG09784, AACGATAATGACATTGGAAACAGATCACACTGGGATGGCGGTTGAACCATGGCGCAATAT, WBGene00031307
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term