WormMine: Gene WBGene00030269

• WormBase Gene ID: WBGene00030269
• Gene Name: CBG08487
• Sequence Name: CBG08487
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Nucleoside diphosphate kinase; Nucleoside diphosphate kinase-like domain superfamily; and Nucleoside diphosphate kinase-like domain. Is an ortholog of C. elegans Y48G8AL.15.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08487.1	CBG08487.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08487	CBG08487		[unknown]

0 RNAi Result

10 Allele

• WBVar00136912
• WBVar00136911
• WBVar00136914
• WBVar00136913
• WBVar00136916
• WBVar00136915
• WBVar00136918
• WBVar00136917
• WBVar00136919
• WBVar00136920

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053933
• Remark: CBG08487, AGAAATTTGCACTTTCCGATGTTAGAAATGTTGCACATGCAAGTGATGAGGATGCGGCGA, WBGene00030269
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term