WormMine: Gene WBGene00029981

• WormBase Gene ID: WBGene00029981
• Gene Name: Cbr-aex-3
• Sequence Name: CBG08121
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: DENN domain, C-terminal lobe; dDENN domain; cDENN domain; uDENN domain; MAP kinase-activating death domain protein; and DENN (AEX-3) domain. Is an ortholog of C. elegans aex-3. In C. elegans, aex-3 is involved in several processes, including egg-laying behavior; mating; and positive regulation of digestive system process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08121b.2	CBG08121b.2		[unknown]
Transcript:CBG08121b.1	CBG08121b.1		[unknown]
Transcript:CBG08121a.1	CBG08121a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08121a	CBG08121a		[unknown]
CDS:CBG08121b	CBG08121b		[unknown]

0 RNAi Result

2 Allele

• WBVar00136815
• WBVar00136816

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063816
• Remark: Cbr-aex-3, CCACCGAGCGATGGTGGTACGAACGTCTTGTGAATATCACATACTCTCCGAAAACAAAAA, WBGene00029981
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term