WormMine: Gene WBGene00028971

• WormBase Gene ID: WBGene00028971
• Gene Name: CBG06738
• Sequence Name: CBG06738
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Alpha/Beta hydrolase fold and Serine aminopeptidase, S33. Is an ortholog of C. elegans C50B6.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06738.1	CBG06738.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06738	CBG06738		[unknown]

0 RNAi Result

23 Allele

• WBVar00136518
• WBVar00136517
• WBVar00136519
• WBVar00136521
• WBVar00136520
• WBVar00136523
• WBVar00136522
• WBVar00136525
• WBVar00136524
• WBVar00136527
• WBVar00136526
• WBVar00136529
• WBVar00136528
• WBVar00136530
• WBVar00111673
• WBVar00111674
• WBVar00111668
• WBVar00111669
• WBVar00111666
• WBVar00111667
• WBVar00111671
• WBVar00111672
• WBVar00111670

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052468
• Remark: CBG06738, GGATTCCTGGTGTTGATCATTATTTCGATTTGGATGAACAAGTACTGAAACGACTTGAAA, WBGene00028971
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term