WormMine: Gene WBGene00028339

• WormBase Gene ID: WBGene00028339
• Gene Name: Cbr-kdin-1
• Sequence Name: CBG05992
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: KAP family P-loop domain; Ankyrin repeat; Ankyrin repeats (many copies); Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; and Ankyrin repeats (3 copies). Is an ortholog of C. elegans kdin-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05992b.1	CBG05992b.1		[unknown]
Transcript:CBG05992a.1	CBG05992a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05992a	CBG05992a		[unknown]
CDS:CBG05992b	CBG05992b		[unknown]

0 RNAi Result

10 Allele

• WBVar00136451
• WBVar00040864
• WBVar00111194
• WBVar00111195
• WBVar00111192
• WBVar00111193
• WBVar00111198
• WBVar00111199
• WBVar00111196
• WBVar00111197

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065119
• Remark: Cbr-tag-144, GACGTTCCATCGAACCGTCTCGACTCAATTCTCGATCGCTTCTACAAACTGAATCTGTGT, WBGene00028339
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term