WormMine: Gene WBGene00037458

• WormBase Gene ID: WBGene00037458
• Gene Name: Cbr-coq-8
• Sequence Name: CBG17957
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein kinase-like domain superfamily; ADCK3-like domain; and ABC1 atypical kinase-like domain. Is an ortholog of C. elegans coq-8. In C. elegans, coq-8 is involved in ubiquinone biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17957.1	CBG17957.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17957	CBG17957		[unknown]

0 RNAi Result

2 Allele

• WBVar00138701
• WBVar00025174

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066822
• Remark: Cbr-coq-8, AGGAATGTTCTTGGACGCATTCGTTGCAGTGGCTAGAAGAGAATTGAAGCAAGAGTGTGA, WBGene00037458
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term