WormMine: Gene WBGene00037393

• WormBase Gene ID: WBGene00037393
• Gene Name: CBG17880
• Sequence Name: CBG17880
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: RecQ mediated genome instability protein, N-terminal, subdomain 2; RecQ mediated genome instability protein; RecQ mediated genome instability protein, DUF1767; and RecQ mediated genome instability protein, N-terminal. Is an ortholog of C. elegans Y50D4C.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17880.1	CBG17880.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17880	CBG17880		[unknown]

0 RNAi Result

8 Allele

• WBVar00138693
• WBVar00138692
• WBVar00138695
• WBVar00138694
• WBVar00138697
• WBVar00138696
• WBVar00138699
• WBVar00138698

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054697
• Remark: CBG17880, GAAAGGGGACAGGGGCACCGAAATGGGTGTCTTTTGGGAAAAGAGGACAGAAAGGAGGAC, WBGene00037393
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term