WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035514 Gene Name  Cbr-rimb-1
Sequence Name  ? CBG15191 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Fibronectin type III; Immunoglobulin-like fold; RIMS-binding protein 1/2/3; SH3-like domain superfamily; Variant SH3 domain; SH3 domain; and Fibronectin type III superfamily. Is an ortholog of C. elegans rimb-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15191.1 CBG15191.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15191 CBG15191   [unknown]

0 RNAi Result

3 Allele

Public Name
WBVar00138235
WBVar00138234
WBVar00138236

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-tag-168, CTGCCGCTCCAAACGCCCGTAAAACAAGCACAGCTGTCAAGAAAGCCGATACCGGTGCAA, WBGene00035514   Expr1063442 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term