WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040304 Gene Name  CBG21574
Sequence Name  ? CBG21574 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: LIM domain and Zinc finger, LIM-type. Is an ortholog of C. elegans tag-273. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG21574a.1 CBG21574a.1   [unknown]
Transcript:CBG21574b.1 CBG21574b.1   [unknown]
Transcript:CBG21574c.1 CBG21574c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG21574c CBG21574c   [unknown]
CDS:CBG21574a CBG21574a   [unknown]
CDS:CBG21574b CBG21574b   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00139686

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-tag-273, AAGACGTGGCCATCAAAGCAGAGCACGCGTCGAAGATGACCGCTAAATGGGAGAAGATTC, WBGene00040304   Expr1052500 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG21573, AAGACGAGCACGCTGCATCCGACGAGGAAGAATTTGCAGTTTCCAGTAAGCCCAAGCAAC, WBGene00040303   Expr1051881 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term