WormMine: Gene WBGene00039207

• WormBase Gene ID: WBGene00039207
• Gene Name: Cbr-rnf-5
• Sequence Name: CBG20152
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; Zinc finger, C3HC4 type (RING finger); and Zinc finger, RING-type. Is an ortholog of C. elegans rnf-5. In C. elegans, rnf-5 is involved in several processes, including inductive cell migration; striated muscle cell development; and ubiquitin-dependent protein catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20152b.1	CBG20152b.1		[unknown]
Transcript:CBG20152a.1	CBG20152a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20152b	CBG20152b		[unknown]
CDS:CBG20152a	CBG20152a		[unknown]

0 RNAi Result

12 Allele

• WBVar00139141
• WBVar00139142
• WBVar00139140
• WBVar00139145
• WBVar00139143
• WBVar00139144
• WBVar00139134
• WBVar00139135
• WBVar00139138
• WBVar00139139
• WBVar00139136
• WBVar00139137

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058101
• Remark: Cbr-rnf-5, GGAAACAGCGGCACCGGGATCCAGAATGGCTCAAGAGGAGGAATATTTGTCGAATATTTT, WBGene00039207
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term