WormMine: Gene WBGene00038719

• WormBase Gene ID: WBGene00038719
• Gene Name: Cbr-btb-16.1
• Sequence Name: CBG19516
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SKP1/BTB/POZ domain superfamily and BTB/POZ domain. Is an ortholog of C. elegans btb-16.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19516b.1	CBG19516b.1		[unknown]
Transcript:CBG19516a.1	CBG19516a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19516a	CBG19516a		[unknown]
CDS:CBG19516b	CBG19516b		[unknown]

0 RNAi Result

8 Allele

• WBVar00138988
• WBVar00138989
• WBVar00138986
• WBVar00138987
• WBVar00138991
• WBVar00138992
• WBVar00138990
• WBVar00138993

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062966
• Remark: Cbr-btb-20, CAAATGAAAGAAATCGAAATCAAAGAAGTTTCCTATGAAGATTTCGGACTTCTTCTCTCT, WBGene00038719
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term