WormMine: Gene WBGene00038358

• WormBase Gene ID: WBGene00038358
• Gene Name: Cbr-odr-2
• Sequence Name: CBG19083
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Caenorhabditis elegans ly-6-related and Caenorhabditis elegans ly-6-related protein. Is an ortholog of C. elegans odr-2. In C. elegans, odr-2 is involved in olfactory behavior and response to odorant.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19083a.1	CBG19083a.1		[unknown]
Transcript:CBG19083c.1	CBG19083c.1		[unknown]
Transcript:CBG19083b.1	CBG19083b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19083b	CBG19083b		[unknown]
CDS:CBG19083a	CBG19083a		[unknown]
CDS:CBG19083c	CBG19083c		[unknown]

0 RNAi Result

8 Allele

• WBVar00138927
• WBVar00138928
• WBVar00138929
• WBVar00138930
• WBVar00138933
• WBVar00138934
• WBVar00138931
• WBVar00138932

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063753
• Remark: Cbr-odr-2, GTGTGCATGCCATAATAATCTCTGTAATTTTTCCGTGTCGCCGCCTTGTCTTTTCATTTT, WBGene00038358
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term