WormMine: Gene WBGene00038199

• WormBase Gene ID: WBGene00038199
• Gene Name: Cbr-rme-1
• Sequence Name: CBG18887
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; EF-hand domain pair; EH domain-containing protein 1/3; Cytoskeletal-regulatory complex EF hand; EH domain; Dynamin family; Domain of unknown function (DUF5600); N-terminal EH-domain containing protein; EH domain-containing protein, N-terminal; Dynamin; and Domain of unknown function DUF5600. Is an ortholog of C. elegans rme-1. In C. elegans, rme-1 is involved in several processes, including endocytic recycling; lipid tube assembly involved in organelle fission; and necroptotic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18887a.1	CBG18887a.1		[unknown]
Transcript:CBG18887b.1	CBG18887b.1		[unknown]
Transcript:CBG18887c.1	CBG18887c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18887a	CBG18887a		[unknown]
CDS:CBG18887c	CBG18887c		[unknown]
CDS:CBG18887b	CBG18887b		[unknown]

0 RNAi Result

1 Allele

• WBVar00138902

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061161
• Remark: Cbr-rme-1, CACCATCGAAACGAGGAGTCCAGGATCCAGTTTATCCAACTCTCAATGATAATGATGAAT, WBGene00038199
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term