WormMine: Gene WBGene00040909

• WormBase Gene ID: WBGene00040909
• Gene Name: CBG22314
• Sequence Name: CBG22314
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function DUF3338 and Cytohesin Ubiquitin Protein Inducing Domain. Is an ortholog of C. elegans F07C6.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22314a.1	CBG22314a.1		[unknown]
Transcript:CBG22314b.1	CBG22314b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22314b	CBG22314b		[unknown]
CDS:CBG22314a	CBG22314a		[unknown]

0 RNAi Result

8 Allele

• WBVar00003994
• WBVar00131473
• WBVar00131476
• WBVar00131477
• WBVar00131474
• WBVar00131475
• WBVar00131478
• WBVar00003989

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061526
• Remark: CBG22314, TAGACGGCTCCGTTATTCTATACGACCTGGTCGCATCAACTTCAAATCCAAAAGGCACAT, WBGene00040909
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term