WormMine: Gene WBGene00040029

• WormBase Gene ID: WBGene00040029
• Gene Name: Cbr-sumv-1
• Sequence Name: CBG21184
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Potential DNA-binding domain. Is an ortholog of C. elegans sumv-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21184.1	CBG21184.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21184	CBG21184		[unknown]

0 RNAi Result

20 Allele

• WBVar00044032
• WBVar00129479
• WBVar00129481
• WBVar00129480
• WBVar00129483
• WBVar00129482
• WBVar00129485
• WBVar00129484
• WBVar00129487
• WBVar00129486
• WBVar00129489
• WBVar00129488
• WBVar00129491
• WBVar00030382
• WBVar00129490
• WBVar00129493
• WBVar00129492
• WBVar00030387
• WBVar00129494
• WBVar00030392

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061565
• Remark: CBG21184, GAAAATGTACCGACCACCGGCCGGCGGTCGACCGCTTCCAATGGCTCCGCATCGTGCAAT, WBGene00040029
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term