WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040082 Gene Name  Cbr-nhr-76
Sequence Name  ? CBG21251 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Nuclear hormone receptor-like domain superfamily; Ligand-binding domain of nuclear hormone receptor; and Nuclear hormone receptor, ligand-binding domain. Is an ortholog of C. elegans nhr-76. In C. elegans, nhr-76 is involved in positive regulation of fatty acid beta-oxidation by octopamine signaling pathway; positive regulation of fatty acid beta-oxidation by serotonin receptor signaling pathway; and positive regulation of transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG21251.1 CBG21251.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG21251 CBG21251   [unknown]

0 RNAi Result

3 Allele

Public Name
WBVar00027499
WBVar00129733
WBVar00129734

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-nhr-76, GATTCGTGTGTTTAACGTCATGGAATACGATAAATTGATTGATGATCTCGCTTTTGTTTA, WBGene00040082   Expr1060385 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term