WormMine: Gene WBGene00040634

• WormBase Gene ID: WBGene00040634
• Gene Name: Cbr-mth-2
• Sequence Name: CBG21976
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: GPS motif. Is an ortholog of C. elegans mth-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21976b.1	CBG21976b.1		[unknown]
Transcript:CBG21976a.1	CBG21976a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21976b	CBG21976b		[unknown]
CDS:CBG21976a	CBG21976a		[unknown]

0 RNAi Result

15 Allele

• WBVar00130851
• WBVar00130850
• WBVar00130853
• WBVar00130852
• WBVar00130855
• WBVar00130854
• WBVar00130857
• WBVar00130856
• WBVar00130859
• WBVar00130858
• WBVar00130861
• WBVar00130860
• WBVar00130863
• WBVar00130862
• WBVar00130864

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057733
• Remark: CBG21976, AAGGAACGATTCTATTTTTGATTTTCCTCTACAAACGATATCGAGCTTGGCAATCGGAGA, WBGene00040634
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term