WormMine: Gene WBGene00040722

• WormBase Gene ID: WBGene00040722
• Gene Name: CBG22093
• Sequence Name: CBG22093
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: FAD/NAD(P)-binding domain superfamily; FAD dependent oxidoreductase; GTP-binding protein TrmE/Aminomethyltransferase GcvT, domain 1; Aminomethyltransferase folate-binding domain; FAD dependent oxidoreductase central domain; Glycine cleavage T-protein/YgfZ, C-terminal; Glycine cleavage T-protein C-terminal barrel domain; FAD dependent oxidoreductase, central domain; Glycine cleavage T-protein, C-terminal barrel domain; and Aminomethyltransferase, folate-binding domain. Is an ortholog of C. elegans Y37E3.17.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22093b.1	CBG22093b.1		[unknown]
Transcript:CBG22093a.1	CBG22093a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22093b	CBG22093b		[unknown]
CDS:CBG22093a	CBG22093a		[unknown]

0 RNAi Result

1 Allele

• WBVar00131058

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066831
• Remark: CBG22093, GATGACAAATACGTTCCATCCGGAAACGAAGTGATCCGCATCGATGGACAAGAAGCGAGA, WBGene00040722
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term