WormMine: Gene WBGene00040592

• WormBase Gene ID: WBGene00040592
• Gene Name: Cbr-unc-14
• Sequence Name: CBG21923
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: RUN domain and RUN domain superfamily. Is an ortholog of C. elegans unc-14. In C. elegans, unc-14 is involved in regulation of protein localization and synaptic vesicle localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21923b.1	CBG21923b.1		[unknown]
Transcript:CBG21923a.1	CBG21923a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21923b	CBG21923b		[unknown]
CDS:CBG21923a	CBG21923a		[unknown]

0 RNAi Result

8 Allele

• WBVar00130751
• WBVar00130750
• WBVar00032797
• WBVar00130747
• WBVar00130746
• WBVar00032792
• WBVar00130749
• WBVar00130748

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060299
• Remark: Cbr-unc-14, CAGATGCGTTCGATTGATCACTTCGAGCAGTCAAATCAATAATGGAGTGATCCCAATTGA, WBGene00040592
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term