WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040407 Gene Name  CBG21705
Sequence Name  ? CBG21705 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: Translation machinery associated TMA7. Is an ortholog of C. elegans F49C12.11. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG21705a.2 CBG21705a.2   [unknown]
Transcript:CBG21705a.1 CBG21705a.1   [unknown]
Transcript:CBG21705b.1 CBG21705b.1   [unknown]
Transcript:CBG21705b.2 CBG21705b.2   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG21705a CBG21705a   [unknown]
CDS:CBG21705b CBG21705b   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00003899
WBVar00130332

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG21705, GAAGAAGCAGCAGGAGGAGGCCAAGAAGATCAAGGAGATGGCAGCCAAGGCTGGCCAGCG, WBGene00040407   Expr1066699 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term