WormMine: Gene WBGene00042688

• WormBase Gene ID: WBGene00042688
• Gene Name: Cbr-cnk-1
• Sequence Name: CBG24619
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Pleckstrin homology domain; Sterile alpha motif domain; CRIC domain; PDZ domain; PH domain; Sterile alpha motif/pointed domain superfamily; SAM domain (Sterile alpha motif); Connector enhancer of kinase suppressor of ras; PDZ superfamily; and PH-like domain superfamily. Is an ortholog of C. elegans cnk-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24619a.1	CBG24619a.1		[unknown]
Transcript:CBG24619b.2	CBG24619b.2		[unknown]
Transcript:CBG24619b.1	CBG24619b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24619a	CBG24619a		[unknown]
CDS:CBG24619b	CBG24619b		[unknown]

0 RNAi Result

1 Allele

• WBVar00036054

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052776
• Remark: Cbr-cnk-1, AAATTTGGTTGTGTTTACGGGGTCACTACCTACTTCTCTGTTCGAATCAATATGTGAAAA, WBGene00042688
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term