WormMine: Gene WBGene00042070

• WormBase Gene ID: WBGene00042070
• Gene Name: CBG23810
• Sequence Name: CBG23810
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ribosome biogenesis protein Nop53/GLTSCR2 and Nop53 (60S ribosomal biogenesis). Is an ortholog of C. elegans Y39B6A.33. In C. elegans, Y39B6A.33 is involved in positive regulation of cellular respiration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23810.1	CBG23810.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23810	CBG23810		[unknown]

0 RNAi Result

12 Allele

• WBVar00133406
• WBVar00053309
• WBVar00140130
• WBVar00053314
• WBVar00053299
• WBVar00133401
• WBVar00133404
• WBVar00133405
• WBVar00053319
• WBVar00053304
• WBVar00133402
• WBVar00133403

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068711
• Remark: CBG23810, GGTTGAAGTGGCACAGGGAGGAGCGTCGTACAATCCAGAATCCTCGGAATATCAAGAATA, WBGene00042070
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term