WormMine: Gene WBGene00042399

• WormBase Gene ID: WBGene00042399
• Gene Name: Cbr-alp-1
• Sequence Name: CBG24239
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: LIM domain and Zinc finger, LIM-type. Is an ortholog of C. elegans alp-1. In C. elegans, alp-1 is involved in determination of adult lifespan and nematode pharyngeal pumping.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24239.1	CBG24239.1		[unknown]
Transcript:CBG24239.2	CBG24239.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24239	CBG24239		[unknown]

0 RNAi Result

24 Allele

• WBVar00045179
• WBVar00045149
• WBVar00045119
• WBVar00045184
• WBVar00045154
• WBVar00045124
• WBVar00045159
• WBVar00045129
• WBVar00015819
• WBVar00045164
• WBVar00133972
• WBVar00045134
• WBVar00133973
• WBVar00015824
• WBVar00045169
• WBVar00133976
• WBVar00045139
• WBVar00133977
• WBVar00133974
• WBVar00133975
• WBVar00045174
• WBVar00133978
• WBVar00045144
• WBVar00133979

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061239
• Remark: Cbr-alp-1, GCAACAGTGCATTCTATTTGGAGGCGGGGCTACCGTACTGCGAGCAAGACTGGAACGCGC, WBGene00042399
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term