WormMine: Gene WBGene00042118

• WormBase Gene ID: WBGene00042118
• Gene Name: CBG23872
• Sequence Name: CBG23872
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function (DUF229); Alkaline-phosphatase-like, core domain superfamily; and Protein of unknown function DUF229.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23872.1	CBG23872.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23872	CBG23872		[unknown]

0 RNAi Result

21 Allele

• WBVar00133440
• WBVar00133438
• WBVar00042524
• WBVar00133439
• WBVar00042494
• WBVar00042499
• WBVar00140137
• WBVar00140140
• WBVar00140141
• WBVar00042504
• WBVar00140138
• WBVar00140139
• WBVar00140144
• WBVar00140145
• WBVar00140142
• WBVar00140143
• WBVar00042509
• WBVar00140146
• WBVar00042514
• WBVar00042519
• WBVar00133437

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061570
• Remark: CBG23872, AACTCTCACCCATAATCCGATTTGCAAGGGCTTCCAACATTTCCATACAAATCACACCTT, WBGene00042118
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term