WormMine: Gene WBGene00041436

• WormBase Gene ID: WBGene00041436
• Gene Name: Cbr-gly-5
• Sequence Name: CBG23000
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Nucleotide-diphospho-sugar transferases; Glycosyltransferase 2-like; Glycosyl transferase family 2; Ricin B-like lectins; Ricin-type beta-trefoil lectin domain; and Ricin B, lectin domain. Is an ortholog of C. elegans gly-5. In C. elegans, gly-5 is involved in protein O-linked glycosylation via threonine.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23000a.1	CBG23000a.1		[unknown]
Transcript:CBG23000b.1	CBG23000b.1		[unknown]
Transcript:CBG23000c.1	CBG23000c.1		[unknown]
Transcript:CBG23000d.1	CBG23000d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23000b	CBG23000b		[unknown]
CDS:CBG23000a	CBG23000a		[unknown]
CDS:CBG23000d	CBG23000d		[unknown]
CDS:CBG23000c	CBG23000c		[unknown]

0 RNAi Result

60 Allele

• WBVar00132608
• WBVar00132609
• WBVar00132606
• WBVar00132607
• WBVar00132612
• WBVar00132613
• WBVar00132610
• WBVar00132611
• WBVar00132616
• WBVar00132617
• WBVar00132614
• WBVar00132615
• WBVar00132620
• WBVar00132621
• WBVar00132618
• WBVar00132619
• WBVar00132624
• WBVar00132625
• WBVar00132622
• WBVar00058509
• WBVar00132623
• WBVar00132628
• WBVar00132629
• WBVar00132626
• WBVar00132627
• WBVar00058514
• WBVar00132632
• WBVar00132633
• WBVar00132630
• WBVar00132631

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062224
• Remark: Cbr-gly-5, GATGTCTCTGCCAGAAAGAAGCTTCGTTCGGATTTGGGCTGCAAATCGTTCAAATGGTAC, WBGene00041436
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term