WormMine: Gene WBGene00041308

• WormBase Gene ID: WBGene00041308
• Gene Name: CBG22845
• Sequence Name: CBG22845
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Glutathione S-transferase, C-terminal domain; Thioredoxin-like fold; Glutathione S-transferase N-terminal domain; Glutathione S-transferase, C-terminal domain superfamily; Thioredoxin-like superfamily; and Metaxin, glutathione S-transferase domain. Is an ortholog of C. elegans cdr-1. In C. elegans, cdr-1 is involved in stress response to cadmium ion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22845.1	CBG22845.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22845	CBG22845		[unknown]

0 RNAi Result

1 Allele

• WBVar00026354

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053071
• Remark: CBG22845, CTATCGCCTTGTTGGAATGCCTCAAGCCCTTAAATTCCTATTTCTCCCATTTGTAAAAGC, WBGene00041308
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term