WormMine: Gene WBGene00041997

• WormBase Gene ID: WBGene00041997
• Gene Name: Cbr-hrpu-1
• Sequence Name: CBG23721
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; SAP domain; B30.2/SPRY domain superfamily; AAA domain; Concanavalin A-like lectin/glucanase domain superfamily; and SPRY domain. Is an ortholog of C. elegans hrpu-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23721.1	CBG23721.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23721	CBG23721		[unknown]

0 RNAi Result

7 Allele

• WBVar00133301
• WBVar00133304
• WBVar00133305
• WBVar00133302
• WBVar00133303
• WBVar00009014
• WBVar00133306

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054283
• Remark: CBG23721, GAAGAGGTTGATCAAGCAAGAACACGAGGAGAACGAGAAACTGGACACTGACGCTGTGAT, WBGene00041997
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term