WormMine: Gene WBGene00041976

• WormBase Gene ID: WBGene00041976
• Gene Name: Cbr-nphp-2
• Sequence Name: CBG23685
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; Ankyrin repeats (3 copies); and Ankyrin repeat. Is an ortholog of C. elegans nphp-2. In C. elegans, nphp-2 is involved in protein localization to ciliary inversin compartment.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23685b.1	CBG23685b.1		[unknown]
Transcript:CBG23685a.1	CBG23685a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23685a	CBG23685a		[unknown]
CDS:CBG23685b	CBG23685b		[unknown]

0 RNAi Result

1 Allele

• WBVar00036152

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053423
• Remark: CBG23685, ATTCCAAAATCCGTAGCAGTGTGCCAATCACCGACAAGTATCGCGAGATGCAACGCATCT, WBGene00041976
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term