WormMine: Gene WBGene00041876

• WormBase Gene ID: WBGene00041876
• Gene Name: Cbr-str-116
• Sequence Name: CBG23540
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class r (Str) and Serpentine type 7TM GPCR chemoreceptor Str. Is an ortholog of C. elegans str-116.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23540.1	CBG23540.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23540	CBG23540		[unknown]

0 RNAi Result

3 Allele

• WBVar00132724
• WBVar00132729
• WBVar00132727

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066770
• Remark: Cbr-str-116, CAACTCGGCGCAGTCACTAATTATCAAACTGTTATGGCTCAACTGTATCCTGGAATCGAT, WBGene00041876
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term