WormMine: Gene WBGene00041755

• WormBase Gene ID: WBGene00041755
• Gene Name: CBG23391
• Sequence Name: CBG23391
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Alkaline-phosphatase-like, core domain superfamily; Ectonucleotide pyrophosphatase/phosphodiesterase, nematoda; Type I phosphodiesterase/nucleotide pyrophosphatase/phosphate transferase; and Type I phosphodiesterase / nucleotide pyrophosphatase. Is an ortholog of C. elegans C27A7.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23391.1	CBG23391.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23391	CBG23391		[unknown]

0 RNAi Result

10 Allele

• WBVar00027179
• WBVar00027184
• WBVar00027169
• WBVar00132984
• WBVar00132985
• WBVar00027189
• WBVar00132988
• WBVar00132989
• WBVar00132986
• WBVar00132987

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058282
• Remark: CBG23391, AGGATAGCGGGGATTCAATTCCAGATTGGAGCACTCAGCCACCAACAAAACGTTTATCTC, WBGene00041755
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term