WormMine: Gene WBGene00041807

• WormBase Gene ID: WBGene00041807
• Gene Name: Cbr-frm-7
• Sequence Name: CBG23448
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: FERM N-terminal domain; Band 4.1 domain; FERM C-terminal PH-like domain; FERM, C-terminal PH-like domain; FERM, N-terminal; FERM superfamily, second domain; Ubiquitin-like domain superfamily; FERM central domain; and PH-like domain superfamily. Is an ortholog of C. elegans frm-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23448a.1	CBG23448a.1		[unknown]
Transcript:CBG23448b.1	CBG23448b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23448b	CBG23448b		[unknown]
CDS:CBG23448a	CBG23448a		[unknown]

0 RNAi Result

2 Allele

• WBVar00027274
• WBVar00000765

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1053643
• Remark: Cbr-frm-7, CGAAGACCGTCGTCATGCATAGATTTAAGTTCGCTAGATGGTGGAATAATCAATGGAGGA, WBGene00041807
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term