WormMine: Gene WBGene00041093

• WormBase Gene ID: WBGene00041093
• Gene Name: CBG22559
• Sequence Name: CBG22559
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; RING-type zinc-finger, LisH dimerisation motif; Zinc finger, RING-type; and RING-type zinc-finger. Is an ortholog of C. elegans C45G7.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22559.1	CBG22559.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22559	CBG22559		[unknown]

0 RNAi Result

1 Allele

• WBVar00034337

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062370
• Remark: CBG22559, ACTTCGAAAAACTTCAAAAACCAAGAGACGCGGAGGTCTGAAGCGACTGTTTGGAGGATG, WBGene00041093
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term