WormMine: Gene WBGene00023854

• WormBase Gene ID: WBGene00023854
• Gene Name: CBG00473
• Sequence Name: CBG00473
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function (DUF272) and Protein of unknown function DUF272.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00473.1	CBG00473.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00473	CBG00473		[unknown]

0 RNAi Result

23 Allele

• WBVar00030249
• WBVar00030244
• WBVar00030259
• WBVar00030254
• WBVar00030264
• WBVar00141256
• WBVar00141257
• WBVar00141258
• WBVar00141259
• WBVar00141252
• WBVar00141253
• WBVar00141254
• WBVar00141255
• WBVar00141260
• WBVar00141261
• WBVar00141262
• WBVar00141263
• WBVar00141249
• WBVar00141250
• WBVar00141251
• WBVar00062718
• WBVar00062723
• WBVar00062728

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1059766
• Remark: CBG00473, AACCAGTTGAATTGGGCACTTGGGTCCATATGTATTTTAACGGATCCGAATATCAGAATC, WBGene00023854
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term