WormMine: Gene WBGene00030895

• WormBase Gene ID: WBGene00030895
• Gene Name: CBG09284
• Sequence Name: CBG09284
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function (DUF229); Alkaline-phosphatase-like, core domain superfamily; and Protein of unknown function DUF229. Is an ortholog of C. elegans M03F8.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09284.1	CBG09284.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09284	CBG09284		[unknown]

0 RNAi Result

5 Allele

• WBVar00031704
• WBVar00031699
• WBVar00114738
• WBVar00114739
• WBVar00114740

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050179
• Remark: CBG09284, CGATGAATTAACGGAAACTGAGAATTTGTCTCTTTTGGATGAGGATGGAGATGTAAACCT, WBGene00030895
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term