WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036127 Gene Name  Cbr-ifp-1
Sequence Name  ? CBG16055 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Intermediate filament protein; Lamin tail domain superfamily; and Intermediate filament, rod domain. Is an ortholog of C. elegans ifp-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16055.1 CBG16055.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16055 CBG16055   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00032294
WBVar00123596

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG16054, AGATTAAGGAGATTGAGAAGCTCAGAGAGCAGTGCACATCTATCAGTGTCGAGTTGGAGA, WBGene00036126   Expr1057553 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-ifp-1, CCGTTGTTGCTGAAATCGACTTTTTCGATACCACCATCCATACCAATACATCAATCAGAA, WBGene00036127   Expr1063468 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term