WormMine: Gene WBGene00024469

• WormBase Gene ID: WBGene00024469
• Gene Name: CBG01202
• Sequence Name: CBG01202
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans H10D18.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01202a.1	CBG01202a.1		[unknown]
Transcript:CBG01202b.1	CBG01202b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01202b	CBG01202b		[unknown]
CDS:CBG01202a	CBG01202a		[unknown]

0 RNAi Result

24 Allele

• WBVar00033894
• WBVar00006249
• WBVar00006254
• WBVar00006259
• WBVar00006239
• WBVar00006244
• WBVar00006229
• WBVar00006234
• WBVar00006224
• WBVar00006264
• WBVar00067226
• WBVar00067261
• WBVar00067231
• WBVar00067266
• WBVar00067236
• WBVar00067271
• WBVar00067241
• WBVar00067276
• WBVar00067246
• WBVar00067281
• WBVar00067216
• WBVar00067251
• WBVar00067221
• WBVar00067256

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067560
• Remark: CBG01202, AGGCGTTAGACATTTGCGAGAGATTACGGGTCAGAAATTGTGGACATATTGCTTTATATC, WBGene00024469
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term