WormMine: Gene WBGene00000329

• WormBase Gene ID: WBGene00000329
• Gene Name: Cbr-fem-3
• Sequence Name: CBG21774
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans fem-3. In C. elegans, fem-3 is involved in several processes, including positive regulation of reproductive process; regulation of germ cell proliferation; and sex determination.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21774.1	CBG21774.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21774	CBG21774		[unknown]

0 RNAi Result

7 Allele

• WBVar00130449
• WBVar00130448
• WBVar00130451
• WBVar00130450
• WBVar00130453
• WBVar00130452
• WBVar00130454

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056792
• Remark: Cbr-fem-3, GCCGTTGGAATCCGAGCTGATTATTGTGCTGGATTGGCTGGCGAAATTGATCATTTGTGA, WBGene00000329
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term