WormMine: Gene WBGene00038761

• WormBase Gene ID: WBGene00038761
• Gene Name: CBG19566
• Sequence Name: CBG19566
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WD repeat-containing protein 31; G-protein beta WD-40 repeat; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans T05A8.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19566.1	CBG19566.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19566	CBG19566		[unknown]

0 RNAi Result

6 Allele

• WBVar00035529
• WBVar00035524
• WBVar00035534
• WBVar00007384
• WBVar00007379
• WBVar00127577

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058733
• Remark: CBG19566, AAAACCCTTTTGGAACGAGGACGTGCCACTGGAAGCTGACAATCTTCAAGTCTGCACATA, WBGene00038761
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term