WormMine: Gene WBGene00027437

• WormBase Gene ID: WBGene00027437
• Gene Name: CBG04834
• Sequence Name: CBG04834
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans F57A8.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04834.1	CBG04834.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04834	CBG04834		[unknown]

0 RNAi Result

20 Allele

• WBVar00036909
• WBVar00036904
• WBVar00036919
• WBVar00036914
• WBVar00036929
• WBVar00036924
• WBVar00036899
• WBVar00036894
• WBVar00109706
• WBVar00109707
• WBVar00109708
• WBVar00008749
• WBVar00008754
• WBVar00008739
• WBVar00008744
• WBVar00008724
• WBVar00008729
• WBVar00008734
• WBVar00008714
• WBVar00008719

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070278
• Remark: CBG04834, GCCAAGAGAGGAAGACTCGATAGTCATCGTCCATCGTTGGACTTTGAGAAAATGGTCAAA, WBGene00027437
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term