WormMine: Gene WBGene00025353

• WormBase Gene ID: WBGene00025353
• Gene Name: Cbr-snpc-1.2
• Sequence Name: CBG02273
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-htz-1 and Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: snRNA-activating protein complex subunit 1 and Small nuclear RNA activating complex (SNAPc), subunit 1. Is an ortholog of C. elegans snpc-1.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02273a.1	CBG02273a.1		[unknown]
Transcript:CBG02273b.1	CBG02273b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02273a	CBG02273a		[unknown]
CDS:CBG02273b	CBG02273b		[unknown]

0 RNAi Result

7 Allele

• WBVar00141730
• WBVar00107169
• WBVar00107174
• WBVar00107173
• WBVar00107172
• WBVar00107171
• WBVar00107170

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1060031
• Remark: CBG02273, AACTAGGATTAGTTCATTCCAAGTACATAAATCTGAAGAAGCGCATCGGGTTCACCGGCG, WBGene00025353
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term