WormMine: Gene WBGene00026267

• WormBase Gene ID: WBGene00026267
• Gene Name: Cbr-gon-4
• Sequence Name: CBG03398
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans gon-4. In C. elegans, gon-4 is involved in gonad development and positive regulation of cell division.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03398b.1	CBG03398b.1		[unknown]
Transcript:CBG03398a.1	CBG03398a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03398b	CBG03398b		[unknown]
CDS:CBG03398a	CBG03398a		[unknown]

0 RNAi Result

7 Allele

• WBVar00039979
• WBVar00108313
• WBVar00108312
• WBVar00108311
• WBVar00108310
• WBVar00108309
• WBVar00108308

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054452
• Remark: Cbr-gon-4, CTGAAAACAGTGCGAAATTTCACAGAGTCAATGATTCCGTCATTTGTACCAGATCTTCCG, WBGene00026267
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term