WormMine: Gene WBGene00026236

• WormBase Gene ID: WBGene00026236
• Gene Name: Cbr-ndnf-1
• Sequence Name: CBG03362
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Neuron-derived neurotrophic factor, first Fn(III) domain; Fibronectin type III superfamily; and Protein NDNF. Is an ortholog of C. elegans ndnf-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03362.1	CBG03362.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03362	CBG03362		[unknown]

0 RNAi Result

5 Allele

• WBVar00039924
• WBVar00039919
• WBVar00039914
• WBVar00108286
• WBVar00108285

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052802
• Remark: CBG03362, AATGTGACTCTGCAACAATTCAATGGATGCGTGGTCAGGATGAGCATTTGAAATACTGTG, WBGene00026236
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term