WormMine: Gene WBGene00023678

• WormBase Gene ID: WBGene00023678
• Gene Name: Cbr-ensh-1
• Sequence Name: CBG00249
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Fibrinogen, alpha/beta/gamma chain, C-terminal globular domain; Fibrinogen-like, C-terminal; Fibrinogen beta and gamma chains, C-terminal globular domain; and Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1. Is an ortholog of C. elegans ensh-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00249.1	CBG00249.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00249	CBG00249		[unknown]

0 RNAi Result

11 Allele

• WBVar00039719
• WBVar00011499
• WBVar00060588
• WBVar00060573
• WBVar00060593
• WBVar00011489
• WBVar00060578
• WBVar00011494
• WBVar00060598
• WBVar00060583
• WBVar00060568

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051396
• Remark: CBG00249, AATGACAAGCGATATTTCGTCTGGGCACATGATAAGCACACCATTCACGGATACCCATAC, WBGene00023678
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term