WormMine: Gene WBGene00087828

• WormBase Gene ID: WBGene00087828
• Gene Name: CBG26414
• Sequence Name: CBG26414
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger C2H2-type and Zinc finger C2H2 superfamily.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG26414b.1	CBG26414b.1		[unknown]
Transcript:CBG26414a.1	CBG26414a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG26414a	CBG26414a		[unknown]
CDS:CBG26414b	CBG26414b		[unknown]

0 RNAi Result

8 Allele

• WBVar00039589
• WBVar00039584
• WBVar00039599
• WBVar00039594
• WBVar00011309
• WBVar00011304
• WBVar00011299
• WBVar00011294

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050745
• Remark: CBG26414, TCCACTGAAAAGAGTGACGTGTCAAGAGTGTAATCGAGAAGTCAGCAACGTACATGCCGA, WBGene00087828
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term