Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG02221.1 | CBG02221.1 | [unknown] |
Other
6 Allele
Public Name |
---|
WBVar00135955 |
WBVar00135956 |
WBVar00135957 |
WBVar00135958 |
WBVar00135959 |
WBVar00135960 |
2 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-htz-1(gu167)_upregulated | |
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Cbr-mus-101, ATACCTCTATACGTCATCGACTTTGTCTACGAATATCTGGTCAACAAAGATAACTTGGAT, WBGene00025307 | Expr1066582 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |