WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025307 Gene Name  Cbr-mus-101
Sequence Name  ? CBG02221 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-htz-1 and Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: twin BRCT domain; BRCT domain; BRCA1 C Terminus (BRCT) domain; BRCT domain superfamily; BRCT domain, a BRCA1 C-terminus domain; and Regulator of Ty1 transposition protein 107 BRCT domain. Is an ortholog of C. elegans mus-101. In C. elegans, mus-101 is involved in several processes, including DNA damage response; DNA-templated DNA replication; and germ cell proliferation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG02221.1 CBG02221.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG02221 CBG02221   [unknown]

0 RNAi Result

6 Allele

Public Name
WBVar00135955
WBVar00135956
WBVar00135957
WBVar00135958
WBVar00135959
WBVar00135960

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-htz-1(gu167)_upregulated
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-mus-101, ATACCTCTATACGTCATCGACTTTGTCTACGAATATCTGGTCAACAAAGATAACTTGGAT, WBGene00025307   Expr1066582 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term